Internal ID | 1979715 | Source Database | TransTermHP TERM 344 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 344
|
Sequence |
GCCCCGGCCGCTCGCGCGCCGGGGC Look for more occurrences |
Start | 1508842 |
End | 1508866 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia dolosa AU0158 chromosome 2, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGGGACGCAAAAAA(5' tail) GCCCCGG-CGC(5' stem) GCGA(loop) GCGGCCGGGGC(3' stem) CAACGGAACAACCAC(3' tail). Confidence: 100. gap 1 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|