| Internal ID | 1761196 | Source Database | TransTermHP TERM 933 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 933
|
| Sequence |
GGCGATGACTTTCCGGTCATCGCC Look for more occurrences |
| Start | 2995889 |
| End | 2995912 |
| Strand | + |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCGCCACGAAACGA(5' tail) GGCGATGACT(5' stem) TTCC(loop) GGTCATCGCC(3' stem) TTTTGTTTTTCCAGG(3' tail). Confidence: 100. opp_overlap 2995886 2995889, overlap 2995875 2995872 2995872 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|