Internal ID | 1761148 | Source Database | TransTermHP TERM 873 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 873
|
Sequence |
CGCCGCGTCCTTTCGGGGACGCGGCG Look for more occurrences |
Start | 2834028 |
End | 2834053 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCCGAATGCAAAAA(5' tail) CGCCGCGTCCC(5' stem) CGAA(loop) AGGACGCGGCG(3' stem) TTTTTTTCATCGGGC(3' tail). Confidence: 100. opp_overlap 2834028 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|