Internal ID | 1761103 | Source Database | TransTermHP TERM 814 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 814
|
Sequence |
AACTGCCGCGCGAGACGCGGCAGTG Look for more occurrences |
Start | 2663752 |
End | 2663776 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAGTCCTAAAAAGAA(5' tail) CACTGCCGCG(5' stem) TCTCG(loop) CGCGGCAGTT(3' stem) CGTGTATCAGGGCGA(3' tail). Confidence: 90. opp_overlap 2663754, overlap 2663749 2663754 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|