| Internal ID | 1760715 | Source Database | TransTermHP TERM 238 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 238
|
| Sequence |
GGCGGGCCGCGATGGCCCGCC Look for more occurrences |
| Start | 683900 |
| End | 683920 |
| Strand | + |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGACCGGCGACAATC(5' tail) GGCGGGCCG(5' stem) CGA(loop) TGGCCCGCC(3' stem) TTTCAATTAACTGAT(3' tail). Confidence: 90. opp_overlap 683899 683898 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|