| Internal ID | 1760172 | Source Database | TransTermHP TERM 59 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 59
|
| Sequence |
CGGGCCGCTCTGTCGAGCGGCCCG Look for more occurrences |
| Start | 150942 |
| End | 150965 |
| Strand | - |
| Genomic Context | |
| Replicon | Burkholderia ambifaria AMMD chromosome 2, complete sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGCCGACATGACAA(5' tail) CGGGCCGCTC(5' stem) GACA(loop) GAGCGGCCCG(3' stem) TTGTCTTTTGTCCGG(3' tail). Confidence: 100. opp_overlap 150937, overlap 150939 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|