| Internal ID | 1586700 | Source Database | TransTermHP TERM 603 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 603
|
| Sequence |
CCCGGGCGGCAGGGCCGGCCCGGG Look for more occurrences |
| Start | 2850474 |
| End | 2850497 |
| Strand | + |
| Genomic Context | |
| Replicon | Burkholderia cenocepacia K56-2Valvano ctg7180000002940B, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATAAGCGGGTCGAAA(5' tail) CCCGGGC-GGC(5' stem) AGG(loop) GCCGGCCCGGG(3' stem) TTGTTTTTTCACGTC(3' tail). Confidence: 100. gap 1, opp_overlap 2850464 2850463 2850474, overlap 2850471 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|