Internal ID | 1761261 | Source Database | TransTermHP TERM 1030 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1030
|
Sequence |
CGGCGTGTTTCACGTGAAACACGCCG Look for more occurrences |
Start | 3271061 |
End | 3271086 |
Strand | - |
Genomic Context | |
Replicon | Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCTCACAAACAAAAA(5' tail) CGGCGTGTTTC(5' stem) ACGT(loop) GAAACACGCCG(3' stem) CCCGTTTCCCGCCCA(3' tail). Confidence: 100. opp_overlap 3271058 3271057 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL.
Genome Biol. 2007;8(2):R22.
PubMed ID: 17313685
|